UPDATE 20191125

Since the results I obtained on my final attempt to get this to work failed, I decided to double-check the primer sequences.

Well, I ordered/used the wrong sequences! The two general Crassostrea spp. primers ordered were the 28s primers listed in that paper, instead of the cytochrome oxidase primers! I’ve ordered the correct universal CO primers [which are actually listed in this paper: (Folmer, O., M. Black, W. Hoeh, R. Lutz & R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrate. Mol. Mar. Biol. Biotechnol. 3:294–299.) and will re-run this.

I’m leaving the original post below for posterity:

After isolating DNA earlier today, I ran PCRs on all the samples.

Primers and cycling parameters were taken from this publication:

Haiyan Wang and Ximing Guo “Identification of Crassostrea ariakensis and Related Oysters by Multiplex Species-Specific PCR,” Journal of Shellfish Research 27(3), 481-487, (1 May 2008).

SR ID	Primer Name	Sequence
1727	COreverse	CAGGGGGCCGTTCGCGGTCAACGCT
1726	COCsi546r	AAGTAACCTTAATAGATCAGGGAACC
1725	COCgi269r	TCGAGGAAATTGCATGTCTGCTACAA
1724	COforward	GGGACTACCCCCTGAATTTAAGCAT

This is a multiplex PCR, where the COforward/reverse primers should amplify any Crassostrea spp. DNA (i.e. a positive control - 697bp) and the other two primers will amplify either C.gigas (Cgi269r - 269bp) or C.sikamea (Csi546r - 546bp).

I ended up running this PCR two times, due to:

Ran the gel too far and ran most of the target products off the gel!
Many non-specific bands produced.

First PCR info:

Component	Single Rxn Vol. (uL)	Num. Rxns	Total Volumes (uL)
DNA	4	NA	NA
2x Apex Red Master Mix	12.5	18	225
P1 Mix	1.5	18	27
P2 Mix	1.5	18	27
H2O	5.5	18	99
	25		Add 21uL to each PCR tube

Cycling params:

95^oC for 10mins

30 cycles of:

95^oC 1min
51^oC 1min
72^oC 1min

72^oC 10mins

Run on 0.8% agarose gel.

Since the first PCR didn’t work, I made some changes:

Longer gel (1.5% agarose) to improve ability to resolve lower molecular weight bands.
Increase annealing temp and reduce extension time to try to increasae specificity.
Add primers individually instead of primer mixes. Used 100uM stocks.

Component	Single Rxn Vol. (uL)	Num. Rxns	Total Volumes (uL)
DNA	4	NA	NA
2x Apex Red Master Mix	12.5	18	225
COforward	0.15	18	2.7
Coreverse	0.15	18	2.7
COCgi269r	0.1	18	1.8
COCsi546r	0.1	18	1.8
H2O	8	18	144
	25		Add 21uL to each PCR tube

Cycling params:

95^oC for 10mins

30 cycles of:

95^oC 1min
55^oC 1min
72^oC 45secs

72^oC 10mins

Used the GeneRuler DNA Ladder Mix (ThermoFisher) for all gels:

RESULTS

Gel #1

Gel image from first PCR with too many bands; also ran target bands off gel

Overall, this gel is a mess, so I’m haven’t bothered taking the time to label anything. The ladders should be obvious. The no template control (NTC) is in the lane on the furthest right side of the gel and is blank, as it should be.

All other lanes show many bands, most of them larger than the expected largest band size (697bp).

In addition to that, I ended up running the gel too long (in an attempt to get better resolution of the lower molecular weight PCR products), so I lost any bands <500bp.

Gel #2

Gel image from 2nd PCR with anneal temp of 55C, showing no bands

Although this gel is cleaner and has the full range of the ladder and encompasses all potential band sizes, there’s no amplification in any lane; just primer dimers. That suggests that the changes I made to the cycling parameters were no good.

Guess I’ll repeat the PCR using the original cycling parameters and I’ll be sure to run the products on a large gel to get a better idea of what’s happening here.