UPDATE 20191125

Since the results I obtained on my final attempt to get this to work failed, I decided to double-check the primer sequences.

Well, I ordered/used the wrong sequences! The two general Crassostrea spp. primers ordered were the 28s primers listed in that paper, instead of the cytochrome oxidase primers! I’ve ordered the correct universal CO primers, which are actually listed in this paper:

Folmer, O., M. Black, W. Hoeh, R. Lutz & R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrate. Mol. Mar. Biol. Biotechnol. 3:294–299.

Will re-run this.

I’m leaving the original post below for posterity.

After yesterday’s PCR debacles, I re-ran the PCRs with the original cylcing parameters, on a long 1.5% agarose (1x low TAE) gel.

Primers and cycling parameters were taken from this publication:

Haiyan Wang and Ximing Guo “Identification of Crassostrea ariakensis and Related Oysters by Multiplex Species-Specific PCR,” Journal of Shellfish Research 27(3), 481-487, (1 May 2008).

SR ID	Primer Name	Sequence
1727	COreverse	CAGGGGGCCGTTCGCGGTCAACGCT
1726	COCsi546r	AAGTAACCTTAATAGATCAGGGAACC
1725	COCgi269r	TCGAGGAAATTGCATGTCTGCTACAA
1724	COforward	GGGACTACCCCCTGAATTTAAGCAT

This is a multiplex PCR, where the COforward/reverse primers should amplify any Crassostrea spp. DNA (i.e. a positive control - 697bp) and the other two primers will amplify either C.gigas (Cgi269r - 269bp) or C.sikamea (Csi546r - 546bp).

Master mix calcs:

Component	Single Rxn Vol. (uL)	Num. Rxns	Total Volumes (uL)
DNA	4	NA	NA
2x Apex Master Mix	12.5	18	225
COforward (100uM)	0.15	18	2.7
COreverse (100uM)	0.15	18	2.7
COCgi269r (100uM)	0.1	18	1.8
COCsi546r (100uM)	0.1	18	1.8
H2O	8	18	144
	25		Add 21uL to each PCR tube

Cycling params:

95^oC for 10mins

30 cycles of:

95^oC 1min
51^oC 1min
72^oC 1min

72^oC 10mins

Used the GeneRuler DNA Ladder Mix (ThermoFisher) for all gels:

RESULTS

Gel:

Gel of four PCRs from each group of oysters

Well, despite the very clean appearance of this gel image (defined bands, no bands in NTC), the results are not helpful.

Band of ~700bp should be present in all samples (OCforward/reverse primers should amplify any Crassostrea spp DNA)- it isn’t present in any of them.
The single band generated in each lane is ~500 - 500bp. This band size is relatively close to the expected product size for Crassostrea sikamea detection (546bp).

These results could suggest that they actually all are C.sikamea. However, the C.gigas 1191-SS are supposed to be verified C.gigas; the samples in question were the C.sikamea 1191-SS.

Will discuss with Steven to see how much additional time he’d like to devote to this project to determine if I should re-run each of these samples with the species-specific primers only (i.e. no multiplex).